This week we celebrated National DNA day. Wrapped up in this commemoration are the 20th anniversary of the Human Genome Project's completion, the 70th anniversary of the discovery of the double helix structure of the DNA molecule, and the reason Cosmo's beard is so thick. Our celebrations in SoDu included a review of the "central dogma"—how information flows from DNA to proteins.
## Warmup
– SSH x 20 IC
– Arm circles x 20 IC
– Windmills x 20 IC
– Slow squats x 10 IC
– Slow merkins x 10 IC
Mosey around the peanut with all but Scapula, who took care of his heart and opted to ruck down the ATT instead.
## Main Event
We stopped at a chalk drawing of the following biological sequences:
T. O. B. A. C. C. O. R. O. A. D. *
ACGCGTTGAGCTTGTTGCCGTAGGCGTGCTGATTAG
TGCGCAACTCGAACAACGGCATCCGCACGACTAATC
We paired up, and worked our way down the double-stranded DNA sequence using the following key:
A = Alarm clock x 3
T = T-merkins x 5
G = Gas pumps x 5 IC
C = Crab cakes x 5 IC
One parter followed one strand, the other performed the complement coded by the base on the opposite strand. Once we reached the end, we swapped to the opposite strand. Maybe we were simulating the work of a DNA polymerase?
In any case, there was good mumble chatter about that DNA cartoon character in the first Jurassic Park movie, and an episode of the Simpsons where you learn that Chinese parents have Chinese babies, not by coincidence, but because of DNA!
With 10 minutes left and having worked our way through most of both strands of DNA, we moved to the protein. Each set of three bases code for an amino acid, represented by the single letter amino acid codes above the DNA sequence. These amino acids are strung together into a protein. Don't fact check the spelling of Tobacco Road since there are no amino acids for "O" and "B". But, the others are real. And there are scientists who encode messages and literature in DNA sequences for kicks and giggles, just like we did today.
https://en.wikipedia.org/wiki/DNA_and_RNA_codon_tables
All together, we completed 5 x of each exercise for the "amino acids" in our TOBACCO ROAD protein using the key above plus:
O = one-legged burpee
B = standard burpee
R = red bull smurf jacks
D = derkins (on the new fences)
* = stop
We moseyed back around the peanut, throwing in 5 bonus pull ups on the way.
## Mary
– flutter kicks x 40 IC
## CoT
– Count Chocula's dad is doing much better, Scapula's heart will be back to full strength in the next couple of weeks (fingers crossed).
– The Gambler is 7:30 am this Saturday.
– Site cleanup 8:30 am May 6th.
– YHC is still learning how to do the whole CoT thing, forgetting the name-o-rama and then forgetting to share my own name. Chalk it up to sleep deficits.